Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12643C12
Clone ID IST12643C12
Vector VICTR76
Project tigm

Sequence tag IST12643C12HMF1
Sequence
ATAACTACAACAGACTANNNGCTNAGCCNNCCNGTAGCNNNCNNNNNNANNNACTGAAGGAATGATAGACACCGACACTT
GCTACCTCTAAAAGCTTCTGCTAAAGAGATACCTAGGTCCCTTTCACCACATTTCATTGGTCAAGTGACCCAACTTCCAG
CCTGCTAGGTGAAATGATCAGTGTTATTAATGATAAGGCATACAAGCTACCCAAACACTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13734458..13734677 168
NO GENE  


Sequence tag IST12643C12BBF1
Sequence
TTTGTACTAACACTGTTTTTGTCTTTATCCNGGTACATTGAGCGGAAAGCTTTTCTGGATCGAGTGGACCACAGGCAGTT
TGAAATTGAGCGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI10744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114292622..114292718 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es