Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0772
Clone ID XT0772
Vector pGT0lxf
Project sanger

Sequence tag XT0772
Sequence
CCTCCCTCCTTTTCTCCCCTATCCTCCTCTAATCTCTCCCTGCTCCTGCTTATCATTATATCACCACTCTTCCCCCTCAG
GTACGCGGACAAGATGGCGTCGGTAGCGGGGGACAGCGCTATGGAGGTGGTGCCGGCGCTGGCCGAGGAGGCCGCGGCCG
AGGCGACGGGCCCCAGCTGCCTGGTGCAGCTGCCGGGCGAGGTGCTGGAGTACATCCTGTGCAGCGGCTCGCTCACGGCG
CTGGACATCGGCCGCGTGTCCAGCACCTGCCGCCGCCTGCGCGAGGTGTGCCAGAGCAGCGGGCAGGTGTGGAAGGAGCA
GTTCCGGGTGAGGTGGCCCTCCCTGATGAAGCACTACAGCCCCACCGACTACGTCAATTGGTTAGAGGAATATAAAGTTC
GGCAGAAAGCTGGGTTAGAAGCCCGGAAGATTGTAGCTTCCTTCTCCAAGCGGTTCTTTTCAGAGCAC
Sequence Type mRNA
Unitrap ID UNI2471

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 118426788..118428002 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032898 (Fbxo21) NM_145564 F-box protein 21 Gene [Source:MGI Symbol;Acc:MGI:1924223]

 
Come back to gene ENSMUSG00000032898


For any suggestions or comments, please send an email to unitrap@crg.es