Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13321E2
Clone ID IST13321E2
Vector VICTR74
Project tigm

Sequence tag IST13321E2BBF1
Sequence
CTTANGTCTTCAAATATGGNCNNNTGGAAAGGAAANAANTANAGGGTGGACATTTCAGGTANGACAAATAGTANTGGTGA
TANCTGGGANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13321E2HMF1
Sequence
CTCAACATTTCCAATCCGACCCCGAAGTGGCCTCGCTCCCCCGGCGAGATGGTGAGTGCTCCGGCCGGCGCCGCGGACAC
ACAGACACGCACTCACACGCACACTCGGACCCACGCACACGCGGCGGGCCCCGCGCCCACCGCCGCTTTCGCCTTCTGCA
CTCGGCGCGTCTGATTTTATTTCATGCTTCCTCGATTTCAATTTGCCGGGCCAGGCTTCCCCTGTCCCGGGAGAGCCAGC
CTATCCCGGCTGGAGCTTTCCGGAGTTCCGTGTCCTCGACTGGGCGGAGTANGGTCC
Sequence Type genomic DNA
Unitrap ID UNI6239

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 91566006..91566301 294
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031665 (Sall1) NM_021390 sal-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889585]

 
Come back to gene ENSMUSG00000031665


For any suggestions or comments, please send an email to unitrap@crg.es