Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14363H9
Clone ID IST14363H9
Vector VICTR74
Project tigm

Sequence tag IST14363H9HMF1
Sequence
GTCTCCCCATCCCGAATGAACTCCCACTTCCCGTTGAAGTAGCCCAAGGTATCTCCAGCCGCGCTCAGCACCATGGCAGC
CACATACCTCTCAATCAGCCCCCCACCCATGCTGAGCTTGGCACAGGCGGGCTTATGGGGCAACGGAGACTCCTGGAGAA
GAGCAGAGGAAGATGAATCGGAAAACAAACATCTACACTCTCCCCACAGGCCCTGCCTTAAGCCTAACCCATTCGATCGT
CTTCTATGAGGGATTTGCTGCTCGAGGGTCTTAAGCAAGAGTAAGTCAGTCATCGTGGAGAGAATGCAGCTCTGTAAATA
TTAAGAGAACTGAATCNNGCCNCAGAGCTAGCGGGGAGGGCTGGGACTCTATCACAGCCCAAAGCTCGACTCCNAAGCTT
GNCTCCAGCTGTGTCGTGGTCTCTCGAGGANTGGCNNGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38450412..38450851 424


Sequence tag IST14363H9HMR1
Sequence
NAGACNATACACCAGCAGTTGGCCCAGATGGGTGACTTGGAAGCCATAGATGTGGCACGATGGAGAGTCAGTGATGATAC
CGTCATGCACCTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI12953

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38450321..38450415 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002844 (Adprh) NM_007414 ADP-ribosylarginine hydrolase Gene [Source:MGI Symbol;Acc:MGI:1098234]


Sequence tag IST14363H9BBF1
Sequence
GTCTCCCCATCCCGAATGAACTCCCACTTCCCGTTGAAGTAGCCCAAGGTATCTCCAGCCGCGCTCAGCACCATGGCAGC
CACATACCTCTCAATCAGCCCCCCACCCATGCTGAGCTTGGCACAGGCGGGCTTATGGGGCAACGGAGACTCCTGGAGAA
GAGCAGAGGAAGATGAATCGGAAAACAAACATCTACACTCTCCCCACAGGCCCTGCCTTAAGCCTAACCCATTCGATCGT
CTTCTATGAGGGATTTGCTGCTCGAGGGTCTTAAGCAAGAGTAAGTCAGTCATCGTGGAGAGAATGCAGCTCTGTAAATA
TTAAGAGAACTGAATCANGCCACAGANCTAGCGGGGAGGGCTGGGACTCTATCACAGCCCAAAGCTCGACTCCNAAGCTT
GNCTCCNGCTGTGTCGTGGTCTCTCGAGGANTGNCCNGCNNNTTANANNNNNNNGGTCAAGCCNNGCNNGNCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000002844


For any suggestions or comments, please send an email to unitrap@crg.es