Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14538F3
Clone ID IST14538F3
Vector VICTR74
Project tigm

Sequence tag IST14538F3HMR1
Sequence
GCNNACGCTGCAGCTCGCAGGCTGCCAGGCCGGCCTTCCTACCCGGNTCACCTACCTGCAGGCCGGCTCCCANCCNGCGG
CCANGCCTCGCCCGGCTCNCCTTGGGCATGGCGCCCTTCTTTCTCCTAGGTGCTGAAAAGGTGTCACCTTGAAGCTCCTT
GCTCCTAGTGCTAGAGGGATTCTGAAACTCTCAGACCTTAGCAGTCNATAACATTGGCN
Sequence Type genomic DNA
Unitrap ID UNI29489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165705943..165706157 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST14538F3HMF1
Sequence
GGCAGGGCCTCCCTGTTTGTCTGGAAGGGAGAGCTGAAGCCGAGGAGGGGGAAGGGCAGCCCGACTGAGCCCAGCAACCT
GAGGCCAAGGGTAACTCCTGAGTTGCTTTTGCATTTGAAGAACAACCATGAAGGCTTCTAAACCCACCACTGCCTTTCGC
ATCTGAGCCATGGAGAGGGGGCCCCTTGAATGTGTCTTTCTTCTCAGGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165706159..165706369 211
 
EST/CDNA Est Name
  AK003657.1

 
Come back to gene AK003657.1


For any suggestions or comments, please send an email to unitrap@crg.es