Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13276H8
Clone ID IST13276H8
Vector VICTR74
Project tigm

Sequence tag IST13276H8BBF1
Sequence
TTATATGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGCGCCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI8340 UNI17842 UNI32380 UNI32381 UNI34559 UNI34560 UNI34561 UNI34562

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 34635..34691 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079840 (Zfp131) NP_082521 zinc finger protein 131 Gene [Source:MGI Symbol;Acc:MGI:1919715]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166323: 15065..15121 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079303 (CAAA01120505.1.1.41101) NP_082521 Zinc finger protein 131 [Source:UniProtKB/Swiss-Prot;Acc:Q8K3J5]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 856682..856738 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6434547..6434603 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033768 (Nrxn2) NP_064649 neurexin II Gene [Source:MGI (curated);Acc:Nrxn2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35923932..35923988 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 25104819..25104875 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 33103178..33103234 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022802 (Lmln) NM_172823 leishmanolysin-like (metallopeptidase M8 family) Gene [Source:MGI (curated);Acc:Lmln-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 19971786..19971842 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 65125185..65125241 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8775583..8775639 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5851201..5851257 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15106597..15106653 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19029116..19029172 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 28088508..28088564 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019889 (Ptprk) NM_008983 protein tyrosine phosphatase, receptor type, K Gene [Source:MGI Symbol;Acc:MGI:103310]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4598435..4598491 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29716306..29716362 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3173656..3173712 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 67675567..67675623 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037720 (Tmem33) NM_028975 transmembrane protein 33 Gene [Source:MGI (curated);Acc:Tmem33]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 111025050..111025106 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061298 (4931433A01Rik) NP_084507 ATP/GTP binding protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:1918244]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3116793..3116849 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 45860674..45860730 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69745755..69745811 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044308 (Ubr3) NM_177783 ubiquitin protein ligase E3 component n-recognin 3 Gene [Source:MGI (curated);Acc:Ubr3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 47830973..47831029 57
NO GENE  


Sequence tag IST13276H8HMF1
Sequence
NNNAACTNNNCCCCATTTGTGGAGGTTCCTTGTCTNATACTGTCNTGACACAATTTTTCTTTTCTTTTTCTTTTTTTACC
TTTAATTTAATTTTTTTCTTCTTTCTTTTTATCCTACAGGTCCTTTGTACATATATCACGGTTTCCACTTATTGTTTTTA
TGAGATTCCTGAGCATGTAAGTGAGTGGGTCTCNGTTTCTTGCTTTTCCCTGGGCTCTTTTNNTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 158307459..158307676 206
NO GENE  

 
Come back to gene ENSMUSG00000044308


For any suggestions or comments, please send an email to unitrap@crg.es