Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14599B5
Clone ID IST14599B5
Vector VICTR74
Project tigm

Sequence tag IST14599B5BBF2
Sequence
NCTGGTATTTGAGGCTTGANCCATANTCTNATGCTGCCAGTTGCTCCCAGTATGGCATGTTAATGAATTTACAGATGGGA
ACTGAGGCCCANCCAGGTTACCTGCGTTTTTAGGGGGCCACTGGCCTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI17299

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21262773..21262904 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]


Sequence tag IST14599B5HMR1
Sequence
ACACACCNTTAATCCCAGCACTCAGTAGGCAGAGGCCAAGGGCTCNNNNTNAANTANAGGCTAGTGTTCCNTGACAGCCT
CTGATAAGCCTGGGCTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000033335


For any suggestions or comments, please send an email to unitrap@crg.es