Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10280E11
Clone ID IST10280E11
Vector VICTR76
Project tigm

Sequence tag IST10280E11HMF1
Sequence
AGATTACAATGACATCATTTCCTGATTTCCTCTTAAACCACCCTTGTTCTCTTTCAAATTCAAGACCTTTTCTATGGTGT
GTGTGTGTCCCTAAATACATAAATACAGCCCACTTGGTCTGTATAATGCTATTTGTACATATGTGGTTTTAGGGCTTCCC
CCCCCCTTGGTCTTTTTTCTCTTGTTGAGATAAGTCTCACTGTGTACCCCTGGCTGTTCTGGACCCCTTTATGTANATNA
NGATAGCCTTTTAATTCANATCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCNCTNTN
Sequence Type genomic DNA
Unitrap ID UNI32857

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 93003779..93004077 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036168 (Ccdc38) NM_175488 coiled-coil domain containing 38 Gene [Source:MGI (curated);Acc:Ccdc38-001]


Sequence tag IST10280E11BBF1
Sequence
AGATTACAATGACATCATTTCCTGATTTCCTCTTAAACCACCCTTGTTCTCTTTCAAATTCAAGACCTTTTCTATGGTGT
GTGTGTGTCCCTAAATACATAAATACAGCCCACTTGGTCTGTATAATGCTATTTGTACATATGTGGTTTTAGGGCTTCCC
CCCCCCTTGGTCTTTTTTCTCTTGTTGAGATAAGTCTCACTGTGTACCCCTGGCTGTTCTGGACCCCTTTATGTANATCA
GGATAGCCTTTTAATTCANATCTG
Sequence Type genomic DNA
Unitrap ID UNI32857

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 93003779..93004041 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036168 (Ccdc38) NM_175488 coiled-coil domain containing 38 Gene [Source:MGI (curated);Acc:Ccdc38-001]

 
Come back to gene ENSMUSG00000036168


For any suggestions or comments, please send an email to unitrap@crg.es