Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13944C11
Clone ID IST13944C11
Vector VICTR74
Project tigm

Sequence tag IST13944C11BBF1
Sequence
AGGACAACTCTGGTTCTTGTAGACTTACTTGAAAGTTCAGGTAGGGGTGTCATAGAGCTGAAGTATGTGGAATAAACAGA
GTTCAAGGTCNTGAAAGAAAGGATGAACATGCATGACCTCTTCGTANTTAGCCNGAGCTCCAGACTTANAGGTTGGTTGC
AATGGGGGCTGAAAAGCTGGGGCAAGTGTAAAACTTANAAACAGTTTANAGCTGGTAAAGTGAANGTTGGCTCTTAAGGA
TCAGANCTG
Sequence Type genomic DNA
Unitrap ID UNI5525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26062977..26063224 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005442 (Cic) NP_082158 capicua homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918972]

 
Come back to gene ENSMUSG00000005442


For any suggestions or comments, please send an email to unitrap@crg.es