Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14828A4
Clone ID IST14828A4
Vector VICTR76
Project tigm

Sequence tag IST14828A4HMF1
Sequence
CCTCTATGGAACCTAGTATCAGACAGACACAACAGGATTGGCAGCCTGGAGGCCCTTGCTCAGCTCCCCCAGTCTGTGAA
ACCCTAGTTCTGTAGAAGCAAGGCTGGAAGATGGCTGACGCCCAGCCTCGGGTCTCTCATCCTTCAGTGCTCTGTGCGCT
GTGGTCGTGGTCAGAGGAGCCGGCAAGTTCGGTGTGTTGGCAGTAATGGTGATGANGTGGACNNGCNNGANTGNNCNTCN
Sequence Type genomic DNA
Unitrap ID UNI34564

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95483602..95483834 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]


Sequence tag IST14828A4BBF1
Sequence
CCTCTATGGAACCTAGTATCAGACAGACACAACAGGATTGGCAGCCTGGAGGCCCTTGCTCAGCTCCCCCAGTCTGTGAA
ACCCTAGTTCTGTANAAGCAAGGCTGGAAGATGGCTGACGCCCNNCCTCGGGTCTCTNANCCNTNANTGNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es