Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15056F3
Clone ID IST15056F3
Vector VICTR80
Project tigm

Sequence tag IST15056F3BBF1
Sequence
ATCTTAGAAGTCTGGTAGGGTGGATAATAAGATGATTCCATTTAGTCCAGAGAATGACATTCATTTGCTGTATTTTCAGT
TTTAAATGAGTATGTTTATTAAATATACAGTAAGCCAAAGTAACAGAACAAATAGCAAGTGATAGAAGGCAGATGATAGC
TAGATGGTTAAGTGCTCAATAAATTGATAGATGATTGGTAGGTAGGTAGATAGATAGATAGCTGATAGATAGATAATAGG
TAGCTGATAGATAGTTAAGTAGATAGATACTGACCTAGACGATAATGACAGGTAATTATAGATAGGTGACTGATAGGTAG
ATGATAGATAGTTAAATGTTAGATAGATTGATACATGATTGATAAATAGATGATAGATAATTNANTNTAATTATAAATGG
GTGATTATATGATGATAGCTAGCTNGGTGATGGATAGTTAGAAAGAAAGGAAAGAAGAAAGAGAGAGAAAGANGT
Sequence Type genomic DNA
Unitrap ID UNI30647

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12939087..12939558 464
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]


Sequence tag IST15056F3HMF1
Sequence
ATCTTAGAAGTCTGGTAGGGTGGATAATAAGATGATTCCATTTAGTCCAGAGAATGACATTCATTTGCTGTATTTTCAGT
TTTAAATGAGTATGTTTATTAAATATACAGTAAGCCAAAGTAACAGAACAAATAGCAAGTGATAGAAGGCAGATGATAGC
TAGATGGTTAAGTGCTCAATAAATTGATAGATGATTGGTAGGTAGGTAGATAGATAGATAGCTGATAGATAGATAATAGG
TAGCTGATAGATAGTTAAGTANATAGATACTGACCTAAACGATAATGACAGGTAATTATAGATAGGTGACTGATAGGTAN
ATGATANATAGTTAAATGTTAGATAGATTGANNCNTGATTGATNANTANATGATNNNTNNNTNNGTNNNATTATNNNTGG
GTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15056F3HMR1
Sequence
TATAAGCCTTTCTTTATAAATNAGAGAGGGTTCTAGCTTTTATCTGCATCTTCAGAGAAGACCTGAACTTAAAATGGAGA
CAGCCCTCTTCATTGCACTTACAGATATCTTAAAGCTATCGAGGTCTTGCTATTGATTTGCCTCATTTCCTCAGTAGCTT
CCACCACAGCTCCCAAGACATTGCTGGTGGCCTTCAAGGCTTTGAGCCACCCACCAGACACAGCTATATGCCTGGAGCCA
CATTCTTCCCACAGTTTGACCGTCTTACACTACTCACACAGAATATTCAGTGTAGACACAGCATAACTTCCATATATCAG
AAGTCTAGGTACCTGGCAGAAACTACNAGAATCCCAGTAGAAAGTAAAATGTACTAAAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12938707..12939086 373
NO GENE  

 
Come back to gene ENSMUSG00000021745


For any suggestions or comments, please send an email to unitrap@crg.es