Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12430F10
Clone ID IST12430F10
Vector VICTR76
Project tigm

Sequence tag IST12430F10HMF1
Sequence
CTCTGGAAGAGCAGCAAGTGCTCTTAACAGCTGAGCCATCTCTCCAGCCCCTCAAAACAATATATTATGCTCGTTATTTA
ATGATAAACTGAAATTTTATGTGTAGCAAAATAAAACTTAATCGGTAAGCAGAAGCTGTCATATTTGGTCACCTTTAAAA
AAAAAANNNATTTT
Sequence Type genomic DNA
Unitrap ID UNI8387

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27400720..27400892 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040818 (A630054L15Rik) NP_001127937 family with sequence similarity 116, member A Gene [Source:MGI Symbol;Acc:MGI:2442980]


Sequence tag IST12430F10BBF1
Sequence
CTCTGGAAGAGCAGCAAGTGCTCTTAACAGCTGAGCCATCTCTCCAGCCCCTCAAAACAATATATTATGCTCGTTATTTA
ATGATAAACTGAAATTTTATGTGTANCAAAATAAAACTTAATCGGTAAGCAGAAGCTGTCN
Sequence Type genomic DNA
Unitrap ID UNI8387

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27400720..27400859 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040818 (A630054L15Rik) NP_001127937 family with sequence similarity 116, member A Gene [Source:MGI Symbol;Acc:MGI:2442980]

 
Come back to gene ENSMUSG00000040818


For any suggestions or comments, please send an email to unitrap@crg.es