Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14667E6
Clone ID IST14667E6
Vector VICTR74
Project tigm

Sequence tag IST14667E6BBF1
Sequence
GAAGTTACTACCTTCTGACTTTTACATATATACCATACTTATGTACACACACATATATACGCACAAATAAATGCAAACTT
AAACTTACAAAAAAAAGANAAAACAACTTTTCCCAACCCAACCCATTGTATTTATGTTCACAAATCTTANCTTANAAAAA
TGGACACATCTTTTTTGGGGGGTGGGGAAGGAGGTANACAGGGTCTCTGTGTGTAGCCCATGCAGGTCTAN
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84840151..84840380 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST14667E6HMR1
Sequence
GGGAGTTGGTTCTGTCCTTCAATCCTGTGGGTCCTGGGGGCTGAACTCAGGTCATTANGTTTAGCAGCAAGCACATTTCA
CCACTGATCCATCTTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84840051..84840149 97
NO GENE  

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es