Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13598F6
Clone ID IST13598F6
Vector VICTR74
Project tigm

Sequence tag IST13598F6HMF1
Sequence
GGGACGTACCCCGAGGCTATGAGAATGTACCCATCCCCTGTGTCAATGGTGTGGATGGGGAGCCGTGCCCGGAGGACTAC
AAGTACATCTCTGANAACTGCGAGACATCGACCATGAACATCGACCGCAACATCACCCATCTGCAGGTAAGGCACAGCCC
CGCTCACCATGCTGTGGGAGCACCTCCACACCAGGATGGGGGGCATGAAGACTCCCCCTCACACTGGGACCACCACCACT
CACTGN
Sequence Type genomic DNA
Unitrap ID UNI34565

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35047635..35047879 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013787 (Ehmt2) NM_145830 euchromatic histone lysine N-methyltransferase 2 Gene [Source:MGI (curated);Acc:Ehmt2-003]


Sequence tag IST13598F6BBF1
Sequence
TAGGGACGTNCCCGAGGCTATGAGAATGTACCCATCCCCTGTGTCAATGGTGTGGATGGGGAGCCGTGCCCGGANGACTA
CAAGTACATCTCTGANAACTGCGAGACATCGACCATGAACATCGACCGCAACATCACCCATCTGCAGGTAAGGCACAGCC
CCGCTCACCATGCTGTGGGANCNCCTCCACACCNGGATGGGGGGCATNANNACTCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000013787


For any suggestions or comments, please send an email to unitrap@crg.es