Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14662F3
Clone ID IST14662F3
Vector VICTR74
Project tigm

Sequence tag IST14662F3HMF1
Sequence
TTGTGTCCCCACTGAAGTGGGAGTTCACATAAAAAAAAGAACCTTGGAAGCTAGGGAGGCTGAGGAGGGAGATGTTTCAA
CCTACAACAGATATAAACACACCAAGCGCAGAGGACAAAGACACAAAAGGGCATAGACTCCAAGTGAACCGCCATGCTTT
CAAACAAACACCAGTGAAAACTTTGACCATCCTCCTCTACTGTCAGATCCTGAAATAGATACAAAGGTCANACGATCCAG
TGATAGGAAAGTTTGAGAGTCTGGAACTCGGAGAGTGTGAGTGAACCTCATGACAAACTCCAGCAGCCTTGCCGCCTGCC
TGCCTTCCTAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 122124813..122125144 330
NO GENE  


Sequence tag IST14662F3BBF1
Sequence
TTGTGTCCCCACTGAAGTGGGAGTTCACATAAAAAAAAGAACCTTGGAAGCTAGGGAGGCTGAGGAGGGAGATGTTTCAA
CCTACAACAGATATAAACACACCAAGCGCAGAGGACAAAGACACAAAAGGGCATAGACTCCAAGTGAACCGCCATGCTTT
CAAACAAACACCAGTGAAAACTTTGACCATCCTCCTCTACTGTCANATCCTGAAATAGATACAAAGGTCAAACGATCCAG
TGATAGGAAAGTTTGANAGTCTGGAACTCGGANAGTGTGAGTGAACCTCATGACAAACTCCAGCAGCCTTGCCGCCTGCC
TGCCTTCCTAGTTAACCGCTGAGCATTTGAAAAGTTTATGACCTCTGTCCAACTCACTTGTTCTACAAAGATGACCAANA
CAATACTACNNAACCTGACGACCTTGCAAGCGGANGCNGANGTAGACTGNCCCACTTGCTTCNAGTTGTCTCTGTNNTCT
GAAANGGGATATTNTNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 122124653..122125144 462
NO GENE  


Sequence tag IST14662F3HMR1
Sequence
NNGTAAACAATCTAGGCAGCCTTGGCTCCTGCACGGTTGGAGGAGATACTATTGCTTGCTGTGCAAGCAAGTCATGAACT
TCATGCCTATGATCACATTTAATTTCCACAACAATCCATGAAGACAGGATCGTTC
Sequence Type genomic DNA
Unitrap ID UNI14547

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 122125145..122125276 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028121 (Bcar3) NM_013867 breast cancer anti-estrogen resistance 3 Gene [Source:MGI Symbol;Acc:MGI:1352501]

 
Come back to gene ENSMUSG00000028121


For any suggestions or comments, please send an email to unitrap@crg.es