Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15056F5
Clone ID IST15056F5
Vector VICTR80
Project tigm

Sequence tag IST15056F5HMF1
Sequence
GTGTATACTCACACACGTGTATGTGGAGGCCACAGGAGGATACACAGTGTTTTTCTCTATTGCTTTCTGCACTTATGTTT
TTAGACTGGATTTCTCTGAACCTAGAGCTTGACATTTTGACCAGGTCAGTTGGCCTGTGAGTATCTAGGATCTGCCTGTC
TCTGCCCCTATCGCTGGGGTCACAAGCATACCCAGTTGTGCCTGGCTTTTATGTGGGTGCTGGGAATTTGAAATCCAGAT
CCTGTTGGCTTCACAGCATCTCATACTCACTGAACCTTTTCCATAGTCTCTGTATAGGAACGATTTTTAAAGGGGTGGGT
AGCAGTGAGATAGGATGCAAAAATCCCTTAAAGAGTTNANANTTACTTACTTTGTGCCTATNAGATGCAAGGAANGCTGA
GGANATANTTCNTTGGTGGTGAACNTGNNTTGATGTGCAANGNTN
Sequence Type genomic DNA
Unitrap ID UNI30065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45590475..45590914 418
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


Sequence tag IST15056F5HMR1
Sequence
ACACTCCTGCATAAATAGGTGCTTTTAACACACACAGACACACCAAGATACGTAACAAAATACCTAAGTACTGTTAATTT
ACACTCAGCAGAGACGGTTAATAAAACTGGGGAATGAGCATGGACTCACAGTGAGAAGTTCACCGGAGGCAAAGTTGCTC
CCGCTTTGAAGAACTCTTTACTCTGTTCTGGGAACATGTACGGATTATCCCCTGGTGTCAATTTGGGGATTCCATTTCTG
GGATCAATATCTGTGGGAAATGTCAGAAAACATCACACATCAGGCTGAAGCCNATGCCCTGTCTGCTGTGAGCAACAACC
TGACAGTGAACAATCCGGTCCCTTCATGTTTATCGCAAGATAAATTTGTTATCCCGCCTTANGAAGTTAAAGTTCATGGG
ACTTTTTTCCCCATGCTGTGTTCTCAGATATGATTACTTAAAAACATGGAGGGCCGCANAANANCANCTGTGGAGAGCCN
TCCCCTGGNNGANNCGTGGCTGTNGNTCACACNGGCTCANAGNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45590911..45591432 492
 
EST/CDNA Est Name
  BI100822.1 - BY719067.1

 
Come back to gene BI100822.1 - BY719067.1


For any suggestions or comments, please send an email to unitrap@crg.es