Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15004F12
Clone ID IST15004F12
Vector VICTR78
Project tigm

Sequence tag IST15004F12BBF2
Sequence
CTGGTGATAANTGGAGTTGTGACCNNNNTTNNANTTNCNCCATCTNGATGATGTCATCTCNTGTTGTGTCCNGCCNCNNA
CCNCAACCNGGGTTCTANCCTGGAAAGGCATTTTGGANACCNGNNANANAANAGGGGCTAGGTGGCNANANAAAGGAATG
TANCCNAGACAGTTATTCTGATCNNNNCNCANATTTTACTGTTGCNACNCTCGGTTATGANAGANNGGGGAGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15004F12HMR1
Sequence
TACCTTACTGTGGCGGCTCCATTAAGGCCATCTCCTTGTCCTTCCTCCTCCCAGCCGCGTCTGCTCCAACCGCCACGGTC
TGATCCGCAAATACGGGCTGAACATGTGCCGCCAGTGCTTCCGGCAGTACGCGAAGGACATAGGCTTCATTAAGGTACGC
GCGGTTGGTCGCTGCCGTCCACGATGCACACAGCGGAGGGTTTTAAGAGTTCCAGAAGGGAAGGGTGAAGGGTTTAATGC
CTGGTCAGATTTANGTGTCNGGTGGGTAGGAGGTC
Sequence Type genomic DNA
Unitrap ID UNI14768

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 70259528..70259801 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034892 (Rps29) NM_009093 ribosomal protein S29 Gene [Source:MGI (curated);Acc:Rps29-001]


Sequence tag IST15004F12HMF1
Sequence
GTACAGCACTCCTCAGCTTCCCCACCACCCGCAGCAGGGCCCGCCCGGCCCGGCCTAGCTAAGCCCGTAATGGCGACGGC
AGCACCGAACGCCCTGCGCGCCGCCCGCGGGCCTTGAATTTCCGACACCCAGTCACCAACAATGGCCCTTCCCTCTAACC
GCGGTCTCCACAACCCGCTCCTCACCAAGAGCGGGAACCCTGGCCGAACTTCCGTGGGTGACTCCANTANAGCTGCTGGT
GACCCATCTTGCCTTCNNACNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 70259799..70260054 252

 
Come back to gene Mm.379006 - Mmu.1211 - Mmu.11642


For any suggestions or comments, please send an email to unitrap@crg.es