Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14754H2
Clone ID IST14754H2
Vector VICTR76
Project tigm

Sequence tag IST14754H2HMF1
Sequence
GATGGAAGGAAGGAAGGAAGGTAGAGAGTGCAGCCCATTGTACTGGGAGAGCCATGGGAGCCAATGGGCACCTTGTAGCT
CCCCAGTTGGAAACCAGATAAAACAGGTACTAGCCTGCTTTCTCCAATTCTCTCCAGCCTGGAGCCTCAGCTCCTGGGAT
CCTGCCATCCACTGTTAGAAAGGACTTCCCTCCTCAGATCTCTCATACTCTTTTCTCTTCAGTTCAGAAGCCCTGGGCAC
CAGAGGTTTGTCTCCTTGGTAATTTTATATCCTGTCAAACTGACCAGCACTAACTACCATCGTGACAGAGCCAGGCTCCT
AGTAGGAGGTCTGAGCCCTTCCTAATGGATGGA
Sequence Type genomic DNA
Unitrap ID UNI30928

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 55278597..55278948 352
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032313 (AI118078) NM_172923 Transmembrane protein C15orf27 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q8BZB3]


Sequence tag IST14754H2BBF1
Sequence
GATGGAAGGAAGGAAGGAAGGTAGAGAGTGCAGCCCATTGTACTGGGAGAGCCATGGGAGCCAATGGGCACCTTGTAGCT
CCCCAGTTGGAAACCAGATAAAACAGGTACTAGCCTGCTTTCTCCAATTCTCTCCAGCCTGGAGCCTCAGCTCCTGGGAT
CT
Sequence Type genomic DNA
Unitrap ID UNI30928

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 55278597..55278757 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032313 (AI118078) NM_172923 Transmembrane protein C15orf27 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q8BZB3]


Sequence tag IST14754H2HMR1
Sequence
NTACTTAAGTCTGCCTGTCTGTAAGACGTGGACGCTGGTTGTCTGCCATCCTCCCCTGTGTGGAGTGTCTAGAACAGAGC
CTGGCACCTGGCAGTGCTGCANATGTGTTCCAGGTGTTGTATCCACCTTTTAGACTCTTGGTTCCCAGTGCTGCTCCTTA
TGTCCTCATCCANACTCATGACACCATCTAAGTCCTCANTACCCANCCAGCTCCTGGCCAN
Sequence Type genomic DNA
Unitrap ID UNI4977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29846889..29847107 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024018 (1110021J02Rik) RIKEN cDNA 1110021J02 gene Gene [Source:MGI Symbol;Acc:MGI:1915847]

 
Come back to gene ENSMUSG00000024018


For any suggestions or comments, please send an email to unitrap@crg.es