Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10663H5
Clone ID IST10663H5
Vector VICTR76
Project tigm

Sequence tag IST10663H5HMF1
Sequence
GCTGGGGGGGTAAAAAATGGTGCTTATCCTGGAGTTATTGTTACTGAAGAGGTTGGGTGTGACTGGCTGCTGATAGGAGC
TCTTGTTTGGGCCATGTGTGGAGTAGGGCTCACCTTCAGTCAAGTTTACGGCCTGTCTACTTTAGCCTCANACTCCATGA
GTCACCTTTACACGAGCAGACCCTTGTAGTGCCTGAGGTGCAGATCTGATCGATTTCNNCCTTTCTACCTTTCCTTGTAA
ACAAGAAAGGGACACCCTTGGGTAGGGGAGTTTTATCTCCAGGCCATCTTAAGATCATTCTGTGAGTGCACGGGCCTTGC
TTAGTGTCTGATGGCCTACAGCCAGCACTCTGGAGCAAGTGTAAGCAATTNNCCTTAANAACAAGGTGCGAGTGGATACC
GATGCCCNCCGGGAGTTCCGACAGCTTANCGATTGTTGTANCNNGAGTCCCCTCCCTAAGTGCCAGTTTCTGTGTTATCT
CNNGTCCTGTATGCCGNCGGNNGTCCCCTNNNAN
Sequence Type genomic DNA
Unitrap ID UNI13399

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35643792..35644300 477
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024406 (Pou5f1) NM_013633 POU domain, class 5, transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:101893]

 
Come back to gene ENSMUSG00000024406


For any suggestions or comments, please send an email to unitrap@crg.es