Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10060D5
Clone ID IST10060D5
Vector VICTR75
Project tigm

Sequence tag IST10060D5BBF1
Sequence
GAAACAGGTCTTTCTTTTTCTCCTCTTCTGTGATGTTGTATCCTGCCTCCTCTTACTTTTATTCCTCCTCCTCTTTTTCT
CTTCCTCTTTTCCTCCTCCTCTTCTTTCTCCTAGTTTTCCTCCTCCTATTTCTTTTTGATTTTTTTTTTTTTTTTTTG
Sequence Type genomic DNA
Unitrap ID UNI16328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20473572..20473728 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST10060D5BBR1
Sequence
TTTCCTTAAATCTTACACCTATATCAAGGAGAAAAATGAAAATCCACCCATCCATATTTCCTCTCATATAAAGTTACAGG
TAAAGTGTGAAGGTCAGGAGCTTTATGAAAAGGCAACGGATTTTGTAAAGATCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20473443..20473575 131
NO GENE  

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es