Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12455B7
Clone ID IST12455B7
Vector VICTR76
Project tigm

Sequence tag IST12455B7HMR1
Sequence
TTGTAACCTTGAGGGAGGCCTCTGGTTCCCCACAGGGAGCCAAGGATCCCCTCANCTGCTGGTTTTCCTCTTCCAACCGA
GCCAGCACCCGTTGAGCCTCAAGGTGCCTATCCACCAGGGTGCTGATGCAGGCCTGCAGCTCCTCCAGGGGTTCTGCAGC
TGTACTCTGTGTATTCCCCTTGCCCACGANNNNNNNGGGTAGGCATTTCCACAGTCCTTGGAGGCCGCTAGTCTGGGAGG
CCAGTAGCCTGCGCANCTTATCTGTGGCCTCCTTCTCCAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96488354..96488632 261
 
EST/CDNA Est Name
  AI644271.1


Sequence tag IST12455B7BBF1
Sequence
ACAGCATCCCCGCAAGTGGCCGCCCTGGNGGAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI31125

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96488630..96488668 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es