Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12294H8
Clone ID IST12294H8
Vector VICTR76
Project tigm

Sequence tag IST12294H8BBF1
Sequence
CAATCCCCACAAGCTTTTCTTTGACTTTCACCTATAGTCACAATAAATAATAAAAAAGGAAAAATAAAGCATGTTCCAGA
GACACCCCCCCATTTAGTTATTTATTTACTTATTTTTGGATGTAGGATCTCATGTATCTAGAAATCTCCTGGAACTCACT
ACATAGCCAACATAGTCTGGAACCTGGACATCCTAATATTCTTGATTCAAGAACTGAGGTTGTATATGTGAGTCCCTGTC
CACCATACCCATTTATGCAGTTTTGGGGACTGACCCAGGGGCTCTGCATGCTTCACTATGCCCACTAAGCCACATCCCCA
GCATACTTATATGCTGCTTGCTTGCCTGCCTGTCTTCCTGCCTGCTTTTCTCCTCCTCCTCCTCCTCTTCCTCCTCCTCT
TCCTCCTCTTCCTCCTCTTCCTCCTCCTCCCCTACCCTTTCTTCCTCCCCTCCTCCTCCTCCTNCAGTTGTTTTTCNNGC
TGGCCTTGAACTCTNNATCCTCCTTTANCTTCNTAAGTGTNANNTTACNNNNCCNTTTCATCACATCTGGTCAANANTNC
TTANNTNNTCN
Sequence Type genomic DNA
Unitrap ID UNI11601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51967122..51967684 527
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019891 (Dcbld1) NM_025705 discoidin, CUB and LCCL domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913936]


Sequence tag IST12294H8HMF1
Sequence
CAATCCCCACAAGCTTTTCTTTGACTTTCACCTATAGTCACAATAAATAATAAAAAAGGAAAAATAAAGCATGTTCCAGA
GACACCCCCCCATTTAGTTATTTATTTACTTATTTTTGGATGTAGGATCTCATGTATCTAGAAATCTCCTGGAACTCACT
ACATAGCCAACATAGTCTGGAACCTGGACATCCTAATATTCTTGATTCAAGAACTGAGGTTGTATATGTGAGTCCCTGTC
CACCATACCCATTTATGCAGTTTTGGGGACTGACCCAGGGGCTCTGCATGCTTCACTATGCCCACTAAGCCACATCCCCA
GCATACTTATATGCTGCTTGN
Sequence Type genomic DNA
Unitrap ID UNI11601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51967122..51967461 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019891 (Dcbld1) NM_025705 discoidin, CUB and LCCL domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913936]

 
Come back to gene ENSMUSG00000019891


For any suggestions or comments, please send an email to unitrap@crg.es