Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14981G2
Clone ID IST14981G2
Vector VICTR76
Project tigm

Sequence tag IST14981G2HMR1
Sequence
NTTTTATCCGGTAAAGCGAATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAG
AAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCNAGTGCCTAGTGGGCCACTTTTGGTAANCANAACTGGCGCTG
CGGGATGAACCGAACGCCGGGTTAANGCGCCCGATGCCGACGCTCATCANACCCCAGAAAAGGTGTTGGTTGATATANAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 44964943..44965177 216
 
EST/CDNA Est Name
  W20589.1 - AA412758.1


Sequence tag IST14981G2BBF1
Sequence
AAACTGCGTACGTCGGGAGCGAGAGCGCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGCTACTAGATGGTTCGATT
AGTCTTTCGCCCCTATACCCAGGTCGGACGACCGATTTGCACGTCAGGACCGCTACGGACCTCCACCAGAGTTTCCTCTG
GCTTCGCCCTGCCCAGGCATAGTTCACCATCTTTCGGGTCCTAACGCGTACGCTCGTGCTCCACCTCCCCGGCGCGGCGG
GCGAGACGGGCCGGTGGTGCGCCCTCGGCGGACTGGAGAGGCCTCGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57391395..57391690 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]

 
Come back to gene ENSMUSG00000075007


For any suggestions or comments, please send an email to unitrap@crg.es