Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13115C10
Clone ID IST13115C10
Vector VICTR76
Project tigm

Sequence tag IST13115C10BBF1
Sequence
GANAGAGACACACAAAACAAACTTTAAAAAATTATTGTTGGAAGCTGGGCGTGGTGGCGCACGCCTTTAGTCCCAGCACT
CCGGAGGCAGAGGCAGGCGGATTTCTGAGTTGGAGGCCAGCCTGGTCTACAGAGTGAGCTCCAGGACAGCCAGGGCTATA
CAGAGAAACCTTGTCTCGAAAAACCAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI34573

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74959449..74959644 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019732 (Calr3) NM_029782 calreticulin 3 Gene [Source:MGI (curated);Acc:Calr3-001]

 
Come back to gene ENSMUSG00000019732


For any suggestions or comments, please send an email to unitrap@crg.es