Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13514G12
Clone ID IST13514G12
Vector VICTR74
Project tigm

Sequence tag IST13514G12HMF1
Sequence
CACACAAAACAGCAAAGTAAAACGCAGCAGGGGACTGGA
Sequence Type genomic DNA
Unitrap ID UNI31759

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95482512..95482549 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es