Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14184E10
Clone ID IST14184E10
Vector VICTR74
Project tigm

Sequence tag IST14184E10HMR1
Sequence
NGCAATCNCTTATGAAGGCNNNNGNNNTANNNNNNNNNGGNNNNNNNNNNNNNAAAGATGGTTGGAACTCTCTANAAACC
GTGAGCTCAAGTCTAAGCCNTGTTTCATGTTCCCCCACACCCCAACTTTCCCCACCTTATAGTTACTAAGAGATGTATCT
GAACTGCCGATCCTTGGTGAAATATCTTTCAACAAATCTCTCTATGANGGGCTGAATGCAGAGAACCACAGGACGAANGT
AATGCCTGCCTGTTTTCTGANTAGTGTTCTGGGAAAGCCAN
Sequence Type genomic DNA
Unitrap ID UNI34574

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 72954028..72954306 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005947 (Itgae) NM_008399 integrin alpha E, epithelial-associated Gene [Source:MGI (curated);Acc:Itgae-001]


Sequence tag IST14184E10BBF1
Sequence
GCAGCACCCACCCAGCTATCCAAGCAACAAGTCTGTAGCCACTCCCCCATCCCCCAACTTCAATTACACATGACCTCATG
CCACAACCTCCATCCACAGTCAGTTCCAGACAGCCCTAAAACATCCTGCCTCACACACCCCTTCTCCTTCAGCCCCACTC
CTAGGTCAGGAGACCACACTGCTCTCATCGGACTCTCCACACAATGGTAAACTTGACCATTTGTTCCCACCTCATAGTAA
GGCCTCTCTAGAGAAAATAACATTTGAGTAATGTTATACGAAGTAACTACATTACAAAGGCCCACTGGCTACAATAACAT
TAGCAAGTTAAAAAATAGAAACAACACATAAGAAAGAGACAGGAGAGAAAGGGTGAAGGANNNNNNNCAGACCAGATCAT
GTAATTCTTTGCNCACCAAGAAAGAAGTATGGGTTTTAAGCTAAATGTATCCNACTCNNNNGTCCACNGNNNNNGNNNNN
TTGGANTTTCTGGTCCNAAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000005947


For any suggestions or comments, please send an email to unitrap@crg.es