Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14140E9
Clone ID IST14140E9
Vector VICTR74
Project tigm

Sequence tag IST14140E9HMR1
Sequence
AACCATCGAGGTGGCCGTAAACTTGAGTTTAACATCCAGAACCCACATAGTAAAAGGAGGGAATCAACTCTCACCGGTTG
TCTTCAGATCTCTACTAAATGCTGTGGCATGTGTACAGCCTACACTTACCTCCACAATAAATTAAATTAATGTAAAACAG
TTTAAATAAGGGGTTAGAGAGATGGCTCAGTGGTTAAGTGTGCTTGCTGCTCTTCCANAGGACTGAAGTTGTGTTTTTTG
GACTCCTGTCTATAATTCCNGCTCCANAGCTTCTAACACCTTCTTTTGGACTCTGAAGGCATCTACTGCATGTGTGCATA
CATAAACAGAGACTCACATATACNTAAAGGAACAAAATCTCACTANATAGAAATTATTAANATGATGAANNNTTGTCTCA
NTNNAGGGTTGANNTTGTCATTGCTATTTGTTTTCANACTAACTGGTTCTTAATTACTTGGTTNAACTTNNTANTGCTGT
N
Sequence Type genomic DNA
Unitrap ID UNI14267

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62247247..62247726 442
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es