Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13405E4
Clone ID IST13405E4
Vector VICTR74
Project tigm

Sequence tag IST13405E4HMF1
Sequence
AAGGTCTGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCTAACGAGATCTGATTCCCTCTTCTGGAGTG
TCTGAAGACAGCTACAGTGTACTTACATATAAGTAAATAAATCTTANAAAAAAAAAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 103219468..103492812 122


Sequence tag IST13405E4BBF1
Sequence
AAGGTCTGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCTAACGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI1215 UNI3727 UNI7460 UNI30557 UNI34575

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 34830402..34830463 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022836 (Mylk) NM_139300 myosin, light polypeptide kinase Gene [Source:MGI (curated);Acc:Mylk-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 103219468..103219529 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8983193..8983254 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021149 (Gtpbp4) NM_027000 GTP binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1916487]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75087624..75087685 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72528183..72528244 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 81604735..81604796 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113381256..113381317 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031753 (Cog4) NM_133973 component of oligomeric golgi complex 4 Gene [Source:MGI Symbol;Acc:MGI:2142808]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 145012500..145012561 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122188545..122188606 62
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117141536..117141597 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 183240312..183240373 62
NO GENE  

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es