Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0652
Clone ID XT0652
Vector pGT0lxf
Project sanger

Sequence tag XT0652
Sequence
TTTTTTTCCTTTGGGGGTTTTTCGCCCCATCCCCGTTGGGTAGTTTTTTTTGAACCCCCTTTACCTTTCCGGCATTTTTT
TTTTTTTTTCCTCTAGGACTCCTCTAAGACTCTTTCTCCCCATTTTACTCTTTCTCCTTGTTTTTATGATATCCGGACCT
TTGTTTCCGACGTGACCAGATCATTTCTATTCTCTTTTTTGTTCCACCCCTTGTTATCCATCCCGCCTCTATTTATTTCG
TTCATACTCGTGGCAGAAGGCTCTAGACGTCGAGAGGTAGGAGGCACTTCGGATCGTCCGCAGGGTTTGGGACAGCTACA
GAGGCCGCCACGGAGCCCGCCGGAGCCCCCGTTCCTGCTGGTGCTGCCGCCGCCCGAATCGGAACCGTCGGGCTGCAGCC
GCCGGCAATGCCGCGAAGGAAG
Sequence Type mRNA
Unitrap ID UNI2477

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95171349..95171518 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]

 
Come back to gene ENSMUSG00000038909


For any suggestions or comments, please send an email to unitrap@crg.es