Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11910F3
Clone ID IST11910F3
Vector VICTR76
Project tigm

Sequence tag IST11910F3BBF1
Sequence
CACCCGACTGCTCTTCCGAAGGTNAGGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCT
GT
Sequence Type genomic DNA
Unitrap ID UNI26921 UNI32142 UNI32144 UNI32145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 317878..317958 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 12013067..12013147 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046139 (Patl1) NM_172635 protein associated with topoisomerase II homolog 1 (yeast) Gene [Source:MGI Symbol;Acc:MGI:2147679]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9952561..9952641 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23511041..23511121 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20832230..20832310 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 37884317..37884397 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022292 (Rrm2b) NM_199476 ribonucleotide reductase M2 B (TP53 inducible) Gene [Source:MGI Symbol;Acc:MGI:2155865]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97870704..97870784 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 37788843..37788923 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53117219..53117299 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21354137..21354217 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 94716318..94716398 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 81528370..81528450 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34966905..34966985 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 94213090..94213170 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4925429..4925509 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 49308824..49308904 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 118953147..118953227 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 21748603..21748683 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 53991761..53991841 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023092 (Fhl1) NM_001077361 four and a half LIM domains 1 Gene [Source:MGI (curated);Acc:Fhl1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25197560..25197640 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036646 (Man1b1) NM_001029983 mannosidase, alpha, class 1B, member 1 Gene [Source:MGI (curated);Acc:Man1b1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 111082333..111082413 77
NO GENE  


Sequence tag IST11910F3HMF2
Sequence
CACCCGACTGCTCTTCCGAAGGTCAGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCNTCCGTAACAAGATCT
GACTCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTTAAAAAAAAAAAN
AN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9952561..9952719 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 112070294..112070452 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53117219..53117377 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 64327070..64327228 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 17345012..17345170 157
 
EST/CDNA Est Name
  BY358686.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 139946305..139946463 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 21748603..21748761 157
NO GENE  

 
Come back to gene BY358686.1


For any suggestions or comments, please send an email to unitrap@crg.es