Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11066A9
Clone ID IST11066A9
Vector VICTR76
Project tigm

Sequence tag IST11066A9HMF1
Sequence
ATCTGAAAATCTTTCGTTCCTTTCTTTCTTCCTTCCTTCCTTCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC
TTTCTTTCTTTCTTTCT

Sequence Type genomic DNA
Unitrap ID UNI4546

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24623897..24623984 84
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71844625..71844712 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032228 (Tcf12) NM_011544 transcription factor 12 Gene [Source:MGI Symbol;Acc:MGI:101877]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 139076783..139076869 84
NO GENE  

 
Come back to gene ENSMUSG00000032228


For any suggestions or comments, please send an email to unitrap@crg.es