Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13851H12
Clone ID IST13851H12
Vector VICTR74
Project tigm

Sequence tag IST13851H12BBF1
Sequence
GTTAGTTTTAGAGTTGTCAGGTACAGAAGCTGCCCTTGAGTACACTAGGCACAGAAAATAAGCACTGTCCCAAAATATTG
ACTTACAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI25435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26408284..26408376 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007817 (Zmiz1) NM_183208 zinc finger, MIZ-type containing 1 Gene [Source:MGI Symbol;Acc:MGI:3040693]

 
Come back to gene ENSMUSG00000007817


For any suggestions or comments, please send an email to unitrap@crg.es