Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12174H7
Clone ID IST12174H7
Vector VICTR76
Project tigm

Sequence tag IST12174H7HMR2
Sequence
CTAGGGTGGATAACGTGCAAGTCATTGAAATCNGCATTTCCCAGGACCAAACTTTGTAACTTGAATGATTCTGTTTAGTG
TTTGTTTACCTCTTTCCCCACCCCCAACACTTCANAGCAGAATTCTTTTTTGAAAAGGAACAGATGCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI14434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92038610..92038760 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]


Sequence tag IST12174H7HMF1
Sequence
NCTCCACCTTTGACCTTTTGTTCCTGGGCTATCCCTGACCCTTGGACCCATCCCCCATGCCCCCACCCCANTANCCAGCT
TTCCACTATGACCCTTGACCTCCCGGCACCTGTACATCCCANGCTGGTTTGGA
Sequence Type genomic DNA
Unitrap ID UNI33516

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29575489..29575619 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051735 (Rinl) NM_177158 Ras and Rab interactor-like Gene [Source:MGI Symbol;Acc:MGI:2444024]


Sequence tag IST12174H7BBF1
Sequence
CATAGCAGGTCCAAANTCATCATGANACACANGANAGCCTGTCTCANAAAGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000051735


For any suggestions or comments, please send an email to unitrap@crg.es