Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST15527-NL
Clone ID PST15527-NL
Vector U3NeoSV1
Project escells

Sequence tag PST15527-NL
Sequence
CATGCCCTGCAGCCGGACACCAGCCACTCGGCCTGCAGCAACGGTGATAACCCAG
Sequence Type genomic DNA
Unitrap ID UNI14764

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134659566..134659620 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053877 (Srcap) Snf2-related CREBBP activator protein Gene [Source:MGI Symbol;Acc:MGI:2444036]

 
Come back to gene ENSMUSG00000053877


For any suggestions or comments, please send an email to unitrap@crg.es