Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST15517-NR
Clone ID PST15517-NR
Vector U3NeoSV1
Project escells

Sequence tag PST15517-NR
Sequence
GAATGCGCAGGGCAGGGCGCCCCCTCAAAGCTGCACTGCTCCCACAGGTCCGCGTTCAGTGGCACTCTGCATTGCTGCCT
ACCAAGAGGACCCCGCAATACCTGCGCAAGTGCCTTCGCTCAGACTCAGCGCATTGCCTTTCCAAACCTCAAGGTGGTCA
TGGTAGTGGATGGCAATCGCCAGGAAGATACCTA
Sequence Type genomic DNA
Unitrap ID UNI14765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109398013..109398202 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031910 (Has3) NM_008217 hyaluronan synthase 3 Gene [Source:MGI Symbol;Acc:MGI:109599]

 
Come back to gene ENSMUSG00000031910


For any suggestions or comments, please send an email to unitrap@crg.es