Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST15516-NL
Clone ID PST15516-NL
Vector U3NeoSV1
Project escells

Sequence tag PST15516-NL
Sequence
TTGGGGAGTCTGCAGTCCGACCTGAACAAGCTAGGGGTCGCCACCGTTGCCAAAGGGGTCTGTGGAGCCTGCAAGAAGCC
CATCGCCGGGCAGGTAAGCAGGGGAGGTGGGCAC
Sequence Type genomic DNA
Unitrap ID UNI14767

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 116001938..116002051 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029528 (Pxn) NM_011223 paxillin Gene [Source:MGI (curated);Acc:Pxn-001]

 
Come back to gene ENSMUSG00000029528


For any suggestions or comments, please send an email to unitrap@crg.es