Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10500B11
Clone ID IST10500B11
Vector VICTR76
Project tigm

Sequence tag IST10500B11HMF1
Sequence
TTAGAACACGGAGTAACTGGGAAGCTGAACTGNNNTNANTAACCGAGGAAAATAAAACAAACATGACTGGCATGCACCTG
CAACCCTGGCATTTAGGGGCCAGAGACCGGGAGTCAGAAACTCANGGCTATCCTTGGCTACACTGTGAGTTCNNNACCAT
CCTTTCTTTAAANACTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10500B11BBF1
Sequence
AGTACACTGTGGCTGTCTTCAGACACACCANAAGAGGGCATCAGATCTGTC
Sequence Type genomic DNA
Unitrap ID UNI8624 UNI15065 UNI34580 UNI34581

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 81034353..81034400 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38325767..38325814 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022805 (4932425I24Rik) NM_001081025 RIKEN cDNA 4932425I24 gene Gene [Source:MGI Symbol;Acc:MGI:2443598]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 99047527..99047574 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 104305474..104305521 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 119449246..119449293 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121436109..121436156 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039230 (Tbcd) NM_029878 tubulin-specific chaperone d Gene [Source:MGI (curated);Acc:Tbcd-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21456489..21456536 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 74529998..74530045 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009681 (Bcr) NM_001081412 breakpoint cluster region Gene [Source:MGI Symbol;Acc:MGI:88141]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34706034..34706081 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 86499731..86499778 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143823861..143823908 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55397055..55397102 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028426 (Rad23b) NM_009011 RAD23b homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Rad23b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51383187..51383234 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103155073..103155120 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 4965785..4965832 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 167311510..167311557 46
NO GENE  

 
Come back to gene ENSMUSG00000028426


For any suggestions or comments, please send an email to unitrap@crg.es