Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14949H5
Clone ID IST14949H5
Vector VICTR76
Project tigm

Sequence tag IST14949H5BBF1
Sequence
CATTCTTTTCTGTAACATGTCAACACCTACAGCTTGCTTTTACTGAAAAATAAAAAAAATGAAAAAAGTTCTGCACAGCT
CTTTATTAANACTTCCTAGTAAACTCACTAATGACTGTTTCTCCAAAGCAAACTAACAAATTAATTTACAATTACTTCTC
TTTAATAGCTTACCTTAAAGAACCACCACAGATGCCTTCTGTAGGAAACACTTAATGGAAGGTAACAAGTTTTCCTTTAA
AAAAACAAAACNCAAAACCCAAGATTGNTCTCATGGCCTCANATTCNNTGCATTATTGTNCAGAAGGGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 117869041..117869350 296
NO GENE  


Sequence tag IST14949H5HMF2
Sequence
AGCNATATCTCTAGCCAGTTCTTTTTATAAAGTTTTGCTTACTTATTTGAATTTGTGCACATGTGATTTGTGCATGTATC
TTTGCCTGCTTGAGTGTATGTGCACCATCCCATGGAGGCCAGAACTGAAGTTACAGGCAGTTGTGAGCCACCATGTTGAT
GAGAGGAACTGAACCTTCCTTGGTCCTTGGAAAAACCAACAAATGTTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI30976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37122091..37122303 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024459 (D130003B22Rik) NP_001108547 histocompatibility 2, M region locus 6, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:95918]


Sequence tag IST14949H5HMR1
Sequence
CNGGATACTGGGGATGGAAGACAGGACTGGCTGCATGTTAGGCAATCACTGANNTATACCATCNACCTTTANAAAGAAAA
AAAGATTTATATTTTGCCGGGCATGGTAGCGCACGCCTTTAGTCTCAACACTTGGGAGGCAGTGGCAGACAGATCTCAAG
TTCAAAACCAATTTGGTCTACAAAGAGTTTCAGGATAGCCNGGACTATACAGANAAACCCTGTCTCGAAAACAAAGGTTT
AATTATGTGTCAGGTGGGTTTGTGTACNTGACTTCNGGGCCTAAAGAAGCTGGAAGCAGGCACAGGATCNACNNCNCTGG
CNTGATTTACTTTCTGAGTTTGTGCTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74999742..75000089 322
NO GENE  

 
Come back to gene ENSMUSG00000024459


For any suggestions or comments, please send an email to unitrap@crg.es