Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST15504-NR
Clone ID PST15504-NR
Vector U3NeoSV1
Project escells

Sequence tag PST15504-NR
Sequence
CTCCCAGCCGCGTCTGCTCCAACCGCCACGGTCTGATCCGCAAATACGGGCTGAA
Sequence Type genomic DNA
Unitrap ID UNI14768

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 70259700..70259754 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034892 (Rps29) NM_009093 ribosomal protein S29 Gene [Source:MGI (curated);Acc:Rps29-001]

 
Come back to gene ENSMUSG00000034892


For any suggestions or comments, please send an email to unitrap@crg.es