Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13404B4
Clone ID IST13404B4
Vector VICTR74
Project tigm

Sequence tag IST13404B4HMF1
Sequence
GTCCCTTCTCTCAGTTGCTTCTGCCCGTCATGCTCAGGGTGCTGAGAGAGCCCTGGGGGAGTGCGTCCAAGCCAACGTCT
CACTGACACTCATTGAGGCTGAN
Sequence Type genomic DNA
Unitrap ID UNI31359

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108198288..108198389 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032606 (Nicn1) NM_025449 nicolin 1 Gene [Source:MGI Symbol;Acc:MGI:1913507]


Sequence tag IST13404B4BBF1
Sequence
TTCCCTTCTCTCAGTTGCTTCTGCCCGTCATGCTCAGGGTGCTGANAGAGCCCTGGGGGAGTGCGTCCAAGCCAACGTCT
CACTGACACTCATTGAGGCTGAGGCCCTCCATTACCCCAGAGCAACCACTAAATGAGGAAGACTACTGCTCTTTCCTGTG
ATCANATTGTTTCCCTCTAGTCCTTCCTGGCTTCGTCCCCGGGCAGTATTATTAAGCCGTGCTGCANGGTGTCTCAGATC
NGT
Sequence Type genomic DNA
Unitrap ID UNI31359

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108198289..108198527 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032606 (Nicn1) NM_025449 nicolin 1 Gene [Source:MGI Symbol;Acc:MGI:1913507]

 
Come back to gene ENSMUSG00000032606


For any suggestions or comments, please send an email to unitrap@crg.es