Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12001C10
Clone ID IST12001C10
Vector VICTR76
Project tigm

Sequence tag IST12001C10HMF1
Sequence
CTGTAAGGACTTCTACCTGTTTGATTGTGTTTTCCTGTTTTTCTTTAAGGACTTGTAACTCTTTANCAGTGTTCTCCTGT
ATTTCTTTAAGTGATTTATTAAAGTCCTTCTTGATGCCCTCTACCATCATCATGAGATATGCTTTTAAATCTAGGTCTAG
GTTCTCAGGTGTGTTGGGGTTCCCTGGACTGGGCGAAGTGGGTGTGCTGGGTTCTGGTGATGGTGAGTGGTCTTGGTTCC
TGTTAGTAANATTCCTCCGTTTACCTTTCGCCATCTGGTAATCTCTGGAGTTAGTANTTATAGTTA
Sequence Type genomic DNA
Unitrap ID UNI4014 UNI32291

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4621562..4621866 299
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 33102200..33102504 299
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35520841..35521145 299
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 73295803..73296107 299
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 62340753..62341057 299
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063297 (Luzp2) NM_178705 leucine zipper protein 2 Gene [Source:MGI Symbol;Acc:MGI:1889615]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 29504203..29504507 299
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 51666541..51666845 299
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52990810..52991114 299
 
EST/CDNA Est Name
  AI508299.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 138260734..138261038 299
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 100263942..100264246 299
NO GENE  

 
Come back to gene AI508299.1


For any suggestions or comments, please send an email to unitrap@crg.es