Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10045F9
Clone ID IST10045F9
Vector VICTR75
Project tigm

Sequence tag IST10045F9HMR1
Sequence
ATCTGTGCTGGAACAGGGGAAACTGTGTCTTAAGACTCCGCCCCACAGAAGCTAGTTGGGCCCACGTGGGCCAACGATCG
GCTGGGAGGATGAGAAAAATGACTTTACAATAATGTTTTCTTTTT
Sequence Type genomic DNA
Unitrap ID UNI15588 UNI15589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 27480..27604 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 54250479..54250603 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 84779935..84780059 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 24576871..24576995 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41654453..41654577 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115776709..115776833 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136939804..136939928 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 7565446..7565570 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7469078..7469202 125
NO GENE  


Sequence tag IST10045F9HMF1
Sequence
GATGATCTAGTTGTGTGCTGTAGATGGTGTTTTAAAATGCTGAACAATCAAACCTTAATTTGTATATTAATAGTCAATGC
CATATCTCTGAGCTCGCAATTGCTTAAATTGTTCATCCCTCAGATACTATTAATTCTCAAATTTACAATTGCTTATGCAT
ATTTCTAGTTAATAAATAAATTATGCACATGTGACTCTTAATAACTTTGCAAGCCTTCTAGTTACAACTGCTCCTTAAGA
AAATTGATTAAAAGTGCAATTAGTCACTGCCCCTTTACAGCCAAGTATTTAAAATGTTTTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 136299181..136299483 303
 
EST/CDNA Est Name
  BB759251.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 9873337..9873639 303
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 69661731..69662033 303
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136939926..136940228 303
 
EST/CDNA Est Name
  BI789805.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 133961910..133962212 303
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 28890979..28891281 303
 
EST/CDNA Est Name
  BB785356.1 - CA465789.1 - C89000.1 - BY014396.1 - CA466189.1 - CA463916.1 - BF021819.1

 
Come back to gene BB785356.1 - CA465789.1 - C89000.1 - BY014396.1 - CA466189.1 - CA463916.1 - BF021819.1


For any suggestions or comments, please send an email to unitrap@crg.es