Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14380F2
Clone ID IST14380F2
Vector VICTR74
Project tigm

Sequence tag IST14380F2BBF1
Sequence
GTTCCAAGGCACAAGATGTTCTAAAACTAACTCTGCCCAGAGCCAGTACACAAGCGTGACAGAACCTGGGGTCTGGCCGG
CGCCTTTATCTCCTGATGCAATTTGAGAATGGACACTTACATGAATTCCAGCAATGGGATAGTGGTAAAGCCTTANTAAA
TCGTAAGATAATCAGTGACTGGAAGAGGCAAGATGCAAAACAAACATTTTATACTCAACTTTGAATTCTGCCACAGTGGA
AAAGAGGCTAATGACTTAAACNANACTGCCTAGTTACNATGACNTCNAANNATTAGGAGAACANAAAACNAATGACCCAN
AAAATTCTAANTCNNATGANACACAGCNGCTGGCTNNGNNNANGNGTGTNNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14380F2HMR1
Sequence
GAACTAGTTTAGTGTTATGGCAGATATGGTGTCAGTAGCNAGTGCTGGCATGTGGTTGCAGAGTCAGGAATGCAGCACTT
AACATTTGTTAAGAAAGTCCCGAGACTTAGTAAACCCTTCTGTTGCCTTAATTCCAGGCATAGTAAAGTAGTTTTAGTTA
TTCATATTACTATTTTGTGGCCGTAATTCCCTTCCCTCGCCCCTTGCGAATATGTNNTCCNTGCCGTGTGCANGTTTTAC
CCTTGCANCCAAAATTCTTANCNGACCNCCNGTACGGTTTGAGGGCN
Sequence Type genomic DNA
Unitrap ID UNI20472

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96098387..96098672 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032411 (Tfdp2) NM_178667 transcription factor Dp 2 Gene [Source:MGI Symbol;Acc:MGI:107167]

 
Come back to gene ENSMUSG00000032411


For any suggestions or comments, please send an email to unitrap@crg.es