Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15003B11
Clone ID IST15003B11
Vector VICTR78
Project tigm

Sequence tag IST15003B11BBF1
Sequence
ATATGTAAGTATACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGCGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI2077 UNI12830 UNI26142 UNI34585 UNI34586 UNI34587

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 77949094..77949148 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36008843..36008897 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 51787338..51787392 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 106827150..106827204 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021070 (Bdkrb2) NP_033877 bradykinin receptor, beta 2 Gene [Source:MGI Symbol;Acc:MGI:102845]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70434235..70434289 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 52964324..52964378 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053289 (Ddx10) NP_084212 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 Gene [Source:MGI Symbol;Acc:MGI:1924841]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 42622470..42622524 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72482785..72482839 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 73938170..73938224 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108618401..108618455 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056531 (Ccdc18) NM_028481 coiled-coil domain containing 18 Gene [Source:MGI Symbol;Acc:MGI:1922974]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 103184439..103184493 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112302307..112302361 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055943 (2900064A13Rik) NM_133749 RIKEN cDNA 2900064A13 gene Gene [Source:MGI Symbol;Acc:MGI:1920274]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 136476927..136476981 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042207 (Jarid1b) NM_152895 jumonji, AT rich interactive domain 1B (Rbp2 like) Gene [Source:MGI (curated);Acc:Jarid1b-001]


Sequence tag IST15003B11HMF2
Sequence
ATATGTAAGTATACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGCGTCAGATCTTGTTACAGATGGTTATGAGCCACCA
TGTGGTTGCTGGGATTTGAACTCCTGACCTTCGGGAGAGCAGTCGGGTGCTCTTACCCACTGANCCATCTCACCAGCCCC
AAANACANCTTNNTAAATAANGNNTANCCNCACANNCNCACANAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000042207


For any suggestions or comments, please send an email to unitrap@crg.es