Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12455D11
Clone ID IST12455D11
Vector VICTR76
Project tigm

Sequence tag IST12455D11BBF1
Sequence
GTCCCCACCCNNAAACCTGCCATTTNACANATAGGGACTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12455D11HMR1
Sequence
GGGACNAAATGAGAGCCTGTGAAGGGTGGGTGTTAGCTGTGGAAAGGAACTTGTGTGAAGTTCTTGAATCTAGTTTCGGG
CCCAATGCGCCAGCCTGGAGGAGCATCCCGAGAGCAGGTCTCAGGCTTTCTCAGAGGCTGAGAAAGCTCCAGCACTGCCC
AGTGGGTGCTCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI34589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115139706..115139880 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011884 (Gltp) NM_019821 glycolipid transfer protein Gene [Source:MGI (curated);Acc:Gltp-001]


Sequence tag IST12455D11HMF1
Sequence
GTCCCCACCCCCAAACCTGCCATTTCACAGATAGGGACTCCAAGACACAGATCTACATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115139876..115139935 60
NO GENE  

 
Come back to gene ENSMUSG00000011884


For any suggestions or comments, please send an email to unitrap@crg.es