Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0586
Clone ID XT0586
Vector pGT0lxf
Project sanger

Sequence tag XT0586
Sequence
CCCAACCTTCTTTCTGTCCTCACTTAGCATGATTCTTGCTTCTCTTGAGGCGGTCCTGCCCTATGGGCACGAGGCCCATA
TCCCTCCTTTTTTTTTTTTCTTCCCTTTTGCTGCCTTGAGCTTTGGACCTAGGCTCCGCTCTTACCAGTGGCCCTTAGGC
TCTTAGGCTTTTGGCCTTCCTTAAACTGAGAGCTTCACTCTTGGTTTCCCTAGTTCTGAGGCCTTCAGACTGGGACTGAG
CTCCACCGCCAGCATCTCCGACAGCTTTCAGACTGCCGTGGGCCTTCTCTGTTGCCGCGACTCTGTCTGCTCAACCCTGA
GAAGTGATGGATATTCTTCACAGAGGAGAATTGGTTGCTGCAATACTCCGCAACCG
Sequence Type mRNA
Unitrap ID UNI2401

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 22892256..22938826 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036782 (Klhl13) NM_026167 kelch-like 13 (Drosophila) Gene [Source:MGI (curated);Acc:Klhl13-001]

 
Come back to gene ENSMUSG00000036782


For any suggestions or comments, please send an email to unitrap@crg.es