Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10836G12
Clone ID IST10836G12
Vector VICTR76
Project tigm

Sequence tag IST10836G12HMF1
Sequence
TATTATCCCTTTAGGATGAGGCAAATGGACGTGTGGACAGCACACAGCACAGCAGCCAGGCCTGCCCTCACCTCCTAATG
CTGGCGTACTGAAGGGGTGTTTAAGCGTTCATATGTTCCAGGCTTTCCAAACTCCTCACTTAATGCTCGCAGCAGCCCTC
GGTCCCTCTCTGAAAATAAAAACATCAAGGAGAGGATCAGATAGCTGAGCCACGGCCTCAGAGTCNAAGCTGTCGATTCA
AACCCAGGANACTGCNTANCAGAGCTTCCCCCACTGCCTNNNGATAAGGAAGAAAGTTGAGAGAAAAGCCTTTGGCTCTG
CTGCTTGAGTGTTGGATGATTGACAGTTCATTTANTCTGTCACATTTGCATCCTGTGAAGCATGTGGCAGGCACANNCGT
GTTTTCATTACCTGTGCCTTCCAGTTACCTGCGGTGCTGCATGGACGCTCANATGTATGCTGGTATAAACAGGGGAGAAA
GCTTTCCTGTCTTCAGGGAACNANGGCCGTGTTCACAGANCN

Sequence Type genomic DNA
Unitrap ID UNI8136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28085123..28085640 491
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]


Sequence tag IST10836G12BBF1
Sequence
NTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCTGGTAGAGCANTCANTGCTCTTAACT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84872280..84872346 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 116063396..116063462 63
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 74872236..74872302 63
NO GENE  

 
Come back to gene ENSMUSG00000021895


For any suggestions or comments, please send an email to unitrap@crg.es