Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13986G9
Clone ID IST13986G9
Vector VICTR74
Project tigm

Sequence tag IST13986G9BBF1
Sequence
ATACATGTATTTGTTTAAAAATAAATTGAATATTAAATGTAAGCATTACTGGACATCAGTAATAATCTTTTAAACGGTGT
ATATCCCCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI34590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 50206799..50206892 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039316 (Rftn1) NM_181397 raftlin lipid raft linker 1 Gene [Source:MGI (curated);Acc:Rftn1-001]


Sequence tag IST13986G9HMF2
Sequence
TGGGTACCACATGTCCCTGAGTCTTCCCCTTCCCTGGGTGAGCAGAAGGTCAGGCAGGCCAGGGGAGCCAGCCTCCAGGG
AAAGCCCAGGAGTTTGGGCAACAGTCTGGGCCCCTGGTATGGCCCAAGTGGGGACACTTCTCTAGGCCCCAGCTTCCTAT
CAGTCTATATCTGTCACTTCCTCAGGGAAACCCCTTTGGATGGTTTCTCATAATGGGAGCAACTCTGACTTTTTCCACGA
TGTATTGAATCTAGACTTTAGGTTCTTTTTTTTTTNNNTTTTNCCTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117839158..117839445 278
NO GENE  

 
Come back to gene ENSMUSG00000039316


For any suggestions or comments, please send an email to unitrap@crg.es