Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10959F8
Clone ID IST10959F8
Vector VICTR76
Project tigm

Sequence tag IST10959F8BBF1
Sequence
AGTAGATAAGCGTGCCTGTTGGCCAAGCATGAGGATATGAGTTCAAATCCCTAGCACCCACAGAAATAGCTGATCGTGAC
CGTTTACATCGATAATTCCAGAGCTGCAAGGACTGGAGACTCGAAGGTCACCGGGGCTTGCTGGCTGCCAGCCGGGCCCT
GAATTCTGTCTCCANGAAACAAGGCAGAGAGCGGGAGAAGAGGGCACTTGCTGGCCTCTANTCTCTGCGTGTGTTTGTCG
AGGCTTGGGTATGACCNCNCCACACACTTCACTGGGGCATGGNNNCGCACATNTTTTTTTTTTTTTTTTTTTTTTTTN

Sequence Type genomic DNA
Unitrap ID UNI6780

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30954164..30954480 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST10959F8HMF1
Sequence
AGTAGATAAGCGTGCCTGTTGGAACGCCATCAAAAATAATTCNCGTCTGGCCTTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es