Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13597D3
Clone ID IST13597D3
Vector VICTR74
Project tigm

Sequence tag IST13597D3BBF1
Sequence
CAGAGATCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI3971 UNI18880 UNI34595 UNI34596 UNI34597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 10165409..10165473 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005268 (Prlr) NM_011169 prolactin receptor Gene [Source:MGI Symbol;Acc:MGI:97763]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 55465378..55465442 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51511660..51511724 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036391 (Sec24a) NM_175255 Sec24 related gene family, member A (S. cerevisiae) Gene [Source:MGI (curated);Acc:Sec24a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32460771..32460835 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021900 (Btd) NM_025295 biotinidase Gene [Source:MGI Symbol;Acc:MGI:1347001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41978416..41978480 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031596 (Slc7a2) NM_007514 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 Gene [Source:MGI (curated);Acc:Slc7a2-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93243523..93243587 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 82457259..82457323 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028403 (Zdhhc21) NM_026647 zinc finger, DHHC domain containing 21 Gene [Source:MGI (curated);Acc:Zdhhc21-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 147566451..147566515 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 31673951..31674015 65
NO GENE  

 
Come back to gene ENSMUSG00000028403


For any suggestions or comments, please send an email to unitrap@crg.es